e0m's submissions | Hacker News

31.		Why entrepreneurs still bolt from Boston (betaboston.com)
		1 point by e0m on Feb 18, 2016 \| past
32.		A Year of Code (medium.com/jackiehluo)
		2 points by e0m on Feb 18, 2016 \| past
33.		Physicists in Europe Find Tantalizing Hints of a Mysterious New Particle (nytimes.com)
		2 points by e0m on Dec 16, 2015 \| past
34.		The Oh-My-God particle (wikipedia.org)
		11 points by e0m on Dec 11, 2015 \| past
35.		Researchers find new phase of carbon, make diamond at room temperature (phys.org)
		6 points by e0m on Dec 1, 2015 \| past
36.		Drone Autonomously Avoiding Obstacles at 30 MPH (youtube.com)
		2 points by e0m on Nov 2, 2015 \| past
37.		Open Source Python Flame Chart and How to Reduce CPU Usage by 80% (nylas.com)
		10 points by e0m on Sept 29, 2015 \| past \| 2 comments
38.		Key component to enable 1Tbps wireless via terahertz multiplexing published (nature.com)
		2 points by e0m on Sept 15, 2015 \| past
39.		Tinder's Monetization Strategy Deck [pdf] (businessweek.com)
		17 points by e0m on Sept 2, 2015 \| past \| 4 comments
40.		P values are not as reliable as many scientists assume (2014) (nature.com)
		83 points by e0m on Aug 30, 2015 \| past \| 87 comments
41.		San Francisco Firefighters Become Unintended Safety Net for the Homeless (nytimes.com)
		93 points by e0m on Aug 27, 2015 \| past \| 87 comments
42.		How an enigma machine works and the math behind it (youtube.com)
		3 points by e0m on Feb 1, 2015 \| past
43.		The next evolution of Flux: Relay. Batched data fetching for react components (twitter.com/floydophone)
		3 points by e0m on Jan 28, 2015 \| past
44.		Detailed explanation of WWII era mechanical fire control computer (youtube.com)
		2 points by e0m on Dec 1, 2014 \| past
45.		Flightradar24 Live Flight Track of MH17 (flightradar24.com)
		2 points by e0m on July 17, 2014 \| past
46.		Slow-mo technical video of first seconds of space shuttle engines firing (youtube.com)
		3 points by e0m on April 20, 2014 \| past
47.		λ-Calculus Explained via CoffeeScript (github.com/emorikawa)
		2 points by e0m on Feb 24, 2014 \| past
48.		~+/configure (gnu.org)
		1 point by e0m on Nov 26, 2013 \| past
49.		One Giant Leap for Frogkind (github.com/torvalds)
		1 point by e0m on Nov 25, 2013 \| past
50.		CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC (wolframalpha.com)
		2 points by e0m on Nov 20, 2013 \| past \| 1 comment
51.		Translate a nucleotide (DNA/RNA) sequence to a protein sequence (expasy.org)
		15 points by e0m on Nov 20, 2013 \| past \| 12 comments
52.		Live map of every ship on the planet (marinetraffic.com)
		2 points by e0m on June 7, 2013 \| past
53.		A formal theoretical basis for authorization — BL Authorization Logic (cmu.edu)
		1 point by e0m on Nov 30, 2012 \| past
54.		Tech shades of blue side-by-side incl new Win 8 logo (Can you guess correctly) (adobe.com)
		1 point by e0m on Feb 17, 2012 \| past \| 1 comment
55.		Boilerstrap: A beautiful mashup of HTML5 Boilerplate & Twitter Bootstrap 2.0 (github.com/emorikawa)
		47 points by e0m on Feb 16, 2012 \| past \| 10 comments
56.		Ask HN: Where can I find a better Google Reader + Twitter + RSS of the Future?
		7 points by e0m on Jan 4, 2012 \| past \| 2 comments

HN For You